Introduction
Chickpea (Cicer arietinum L.) is an annual food legume and plays
important role in human and livestock feed (Talebi et
al. 2008). West and North-West of Iran (Kermanshah and Kurdistan provinces)
are the most important chickpea produces with approximately 400 thousand
hectares (Soltani et al. 2016). Chickpea grown
in all zones in Iran and globally Iran ranked third for its cultivation area,
but due to narrow genetic base of chickpea and vulnerability to biotic and
abiotic stresses the average seed yield in Iran is very lover than worldwide
production (Ahmadi et al. 2014; Ghaffari et al. 2014; Farahani
et al. 2019). Fusarium
wilt, caused by F. oxysporum f. sp. ciceri (FOC), is the main destructive soil-borne
disease in chickpea worldwide and under favorable environmental conditions causing20–100%
seed yield losses (Mohamed et al. 2015; Nourollah
and Aliaran 2017). FOC disease management is
difficult due to long term survival of pathogen in soil and also in infected
seeds for years without the present of host plant (Haware
et al. 1996; Nourollah and Aliaran
2017).
Integrated disease management
such as crop rotation, biological control and fungicides application are useful
strategies for disease management, but in term of long survival of FOC pathogen
the best and effective strategy is the using resistance sources in epidemic
regions (Cook et al. 2012; Mengist et al.
2018). Sex in fungi controlled by dissimilar mating type loci named idiomorphs and plays important role of fungi germplasm diversity. Recombination during sex by dissimilar
mating type loci and selection pressure imposed by fungicides enable pathogen
to adopt and breakdown the resistance in commercial cultivars (Waalwijk et al. 2006; Aghamiri
et al. 2015). Characterization of pathogen population structure and
diversity is needed for effective integrated disease management and designing
the best breeding strategies for development of resistant sources.
F. oxysporum f. sp. ciceri isolates
morphology are very similar and difficult for classification and in other hand,
race identification needs to differential chickpea cultivars that is
time-consuming and mostly the reaction of genotypes to pathogens influenced by
environmental parameters (Haware and Nene 1982; Gurjar et al. 2009). Therefore, rapid identification
of population structure in fungi using molecular markers and specific
mating-type markers are very useful and effective (Montakhabi
et al. 2018). Different molecular markers like RAPD (Jimenez-Gasco et al. 2001), ISSR (Barve
et al. 2001; Montakhabi et al. 2018),
RFLP (Sharma et al. 2009), AFLP (Sivaramakrishnan
et al. 2002) and SSR (Dubey and Singh 2008;
Mohamed et al. 2015) have been developed and used for genetic diversity
in FOC populations. Earlier workers reported highly genetic diversity in
Iranian FOC isolates by SSR and did not analyze isolates from diverse provinces
and also mating type systems. Most of FOC isolates used in this study have been
analyzed previously for their morphology and ISSR-based molecular diversity (Montakhabi et al. 2018). Therefore, the objectives
of present study were (i) study the genetic diversity in Iranian FOC isolates
using genic-SSR and EST-SSR markers, (ii) determining the mating type
distribution in geographically collected FOC isolates, (iii) considering the
possible correlation between genetic diversity, mating type and pathogenicity
of FOC isolates with geographical distance.
Materials and
Methods
FOC isolation and
pathogenicity test
Infected chickpea plants were collected from
geographically distant chickpea fields from North-West of Iran in two
provinces; Kurdistan and Kermanshah. Infected stems that
showing vascular discoloration symptoms were washed with distilled water and
sterilized with 1% hypochlorite sodium for 2 min.
Sixty-five samples (Table 1)
were cut into small pieces and plated on potato dextrose agar (PDA) medium and
incubated at 24ºC (Mohamed et al. 2015; Montakhabi
et al. 2018). After 10 days single-spore FOC purified and plated on
potato dextrose broth (PDB) (potato 200 g, dextrose 20 g, agar 18 g and 1 L
water) plates for 10 days. For pathogenicity test, mycelium were harvested and
dissolved in sterilized distilled water. Inoculum suspension was adjusted to 5
×106 conidia/ml. For pathogenicity test, a susceptible chickpea cv. Bivanij were grown in perlite in greenhouse. 14-days old
seedlings were inoculated using root-inoculated method as described by Pande et al. (2007). Two-week-old seedling plants were inoculated using root-inoculated method as
described by Pande et al. (2007).
Twenty eight days after inoculation, seedlings were scored based on
percentage of death plants for each isolates and FOC isolates categorized into
four group based on their pathogenicity; (I) avirulant
FOC isolates (showed 0% wilt), (II) less virulent (showed 1–20% wilt), (III)
moderately virulent (showed 21–50% wilt) and (IV) highly virulent (showed
>51% wilt) (Kashyap et al. 2016).
DNA extraction, mating types and
SSR markers analysis
FOC isolates were cultured on PDB medium and after 8
days, fungal mycelium harvested and used for DNA extraction using CTAB method
as described by Kumar et al. (2013). DNA sample were concentration were
diluted to 20–30 ng μL-1 for
further molecular analysis using SSRs and mating type specific primers.
Mating type of FOC isolates
were analyzed by specific PCR-based primers, MAT1-F (5/-
GTCGTCGATGGTGATGAAAGAAA-3/), MAT1-R (5/-
CCGCACTGGAGCTCAAATGGT-3/), MAT2-F (5/-GTTGCATCTCCGTCTGCGCCA-3/)
and MAT2-R (5/-GGCTG CAAGGATGACTGGCAT-3/) that have been developed previously by Kashyap et
al. (2015). PCR amplification was performed in 20 µL reaction
containing 1× PCR buffer, 20 ng DNA, 4 µM
primers, 250 µM of each dNTP, 2 mM MgCl2 and 1 unit of Taq DNA polymerase. PCR amplifications were done as
follows: initial 95ºC for 3 min, followed by 35 cycles of 94ºC for 1 min, annealing at 57.5/60.8ºC (MAT1/MAT2) for 1
min, extension at 68ºC for1 min and 68 ºC for 10 min as final extension.
For molecular diversity a set
of ten SSR markers (6 genic-SSR and 4 EST-SSR) were
used. These markers have been reported previously for their highly allelic
divergence in different FOC populations (Bogale et
al. 2005; Kumar et al. 2013) (Table 2).
The PCR was performed in 20 µL
reaction volume containing 1× PCR buffer, 15 ng
sample DNA, 4 µM primer, 250 µM of each dNTP, 2 mM MgCl2
and 1 unit of Taq DNA polymerase. PCR Cycles for SSR
were conducted as following: 3 min at 95°C; 32 cycles of 1 min at 94°C, 1 min
of annealing temperature, 2 min at 72°C and finally 7 min at 72°C. PCR products
of mating type specific primers were resolved on 1.5% agarose
gel and SSR primers were resolved on 2.5% metaphoragarose
gel.
Data analysis
FOC isolates mating type determined based on
amplification of a 320 bp and 650 bp
for MAT-1 and MAT-2 locus, respectively.
PCR products
of SSR primers for each FOC were scored as 0 and 1 for absence and present of
bands, respectively. Binary matrix of ten SSR markers was used for cluster
analysis using UPGMA algorithm by DARwin program
package (Perrier and Jacquemoud-Collet 2006).
Polymorphic information content (PIC) value of SSR marker and also Analysis of
molecular variance (AMOVA) were per formed in GenAlex
ver.6.5 software
Results
Pathogenicity and mating types
of the F. oxysporum f. sp. ciceri
Isolates
The virulence and
pathogenicity of FOC isolates were tested on susceptible chickpea cultivar cv. Bivanij. FOC isolates showed high variability for their
pathogenicity. Out of 65 isolates, only four isolates (FOC9, FOC14, FOC34 and
FOC36) were less virulent (1–20% wilt damage) (Table
1). All of these isolates belonged to Kurdistan province. Five isolates (FOC2,
FOC3, FOC18, FOC20 and FOC33) showed highly virulent pattern (>51% wilt
damage) were from Kermanshah province. Remaining 56 FOC isolates belonged to moderately
virulent group (21–50% wilt damage) (Table 1).
Table 1: Description of 65 Iranian isolates of F. oxysporum f. sp. ciceri
for their collection sites, pathogenicity level and mating type alleles
|
FOC ID |
Province |
Pathogenicity level |
Mating type |
FOC ID |
Province |
Pathogenicity level |
Mating type |
|
FOC1 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC36 |
Kurdistan |
less virulent |
MAT-1 |
|
FOC2 |
Kermanshah |
highly virulent |
MAT-1 |
FOC37 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC3 |
Kermanshah |
highly virulent |
MAT-2 |
FOC38 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC4 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC39 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC5 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC40 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC6 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC41 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC7 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC42 |
Kurdistan |
moderately virulent |
MAT-2 |
|
FOC8 |
Kurdistan |
moderately virulent |
MAT-1 |
FOC43 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC9 |
Kurdistan |
less virulent |
MAT-1 |
FOC44 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC10 |
Kurdistan |
moderately virulent |
MAT-1 |
FOC45 |
Kurdistan |
moderately virulent |
MAT-1 |
|
FOC11 |
Kurdistan |
moderately virulent |
MAT-1 |
FOC46 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC12 |
Kurdistan |
moderately virulent |
MAT-2 |
FOC47 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC13 |
Kurdistan |
moderately virulent |
MAT-1 |
FOC48 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC14 |
Kurdistan |
less virulent |
MAT-1 |
FOC49 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC15 |
Kurdistan |
moderately virulent |
MAT-2 |
FOC50 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC16 |
Kurdistan |
moderately virulent |
MAT-1 |
FOC51 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC17 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC52 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC18 |
Kermanshah |
highly virulent |
MAT-1 |
FOC53 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC19 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC54 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC20 |
Kermanshah |
highly virulent |
MAT-2 |
FOC55 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC21 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC56 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC22 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC57 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC23 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC58 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC24 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC59 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC25 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC60 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC26 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC61 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC27 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC62 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC28 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC63 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC29 |
Kermanshah |
moderately virulent |
MAT-1 |
FOC64 |
Kermanshah |
moderately virulent |
MAT-2 |
|
FOC30 |
Kermanshah |
moderately virulent |
MAT-2 |
FOC65 |
Kermanshah |
moderately virulent |
MAT-1 |
|
FOC31 |
Kermanshah |
moderately virulent |
MAT-2 |
|
|
|
|
|
FOC32 |
Kermanshah |
moderately virulent |
MAT-1 |
|
|
|
|
|
FOC33 |
Kermanshah |
highly virulent |
MAT-2 |
|
|
|
|
|
FOC34 |
Kurdistan |
less virulent |
MAT-1 |
|
|
|
|
|
FOC35 |
Kurdistan |
moderately virulent |
MAT-2 |
|
|
|
|
Table 2: SSR markers used for the
genetic diversity study of F. oxysporum f. sp.
ciceri isolates
|
|
Locus |
Primer sequence
(5′-3′) |
Tm (°C) |
No. of Alleles |
PIC |
MI |
|
Genic-SSR |
MB2 |
F: TGCTGTGTATGGATGGATGG R:CATGGTCGATAGCTTGTCTCAG |
57 |
4 |
0.43 |
1.72 |
|
|
MB5 |
F: ACTTGGAGGAAATGGGCTTC R:GGATGGCGTTTAATAAATCTGG |
54 |
3 |
0.35 |
1.05 |
|
|
MB11 |
F: GTGGACGAACACCTGCATC R: AGATCCTCCACCTCCACCTC |
60 |
3 |
0.33 |
0.99 |
|
|
MB14 |
F: CGTCTCTGAACCACCTTCATC R: TTCCTCCGTCCATCCTGAC |
60 |
3 |
0.37 |
1.11 |
|
|
MB17 |
F: ACTGATTCACCGATCCTTGG R: GCTGGCCTGACTTGTTATCG |
60 |
4 |
0.51 |
2.04 |
|
|
MB18 |
F: GGTAGGAAATGACGAAGCTGAC R: TGAGCACTCTAGCACTCCAAAC |
55 |
4 |
0.64 |
2.56 |
|
EST-SSR |
FOL2 |
F: CTCGCATACTACTACCGCACAG R: GCAGATAAGGGAGATGCAAAAC |
58 |
2 |
0.31 |
0.62 |
|
|
FOL4 |
F: CCAGTCAATCCAACCCTACTT R: AGGCTTATCTGCGTCAGTTTCT |
56 |
2 |
0.29 |
0.58 |
|
|
FOL5 |
F: ACCTAACTCTTGGAGGACGAT R: CTGC ATAGCCTTGGTTGTTGTA |
57 |
2 |
0.34 |
0.68 |
|
|
FOL7 |
F: CAAGTC AGC AACC AACACAACT R: GTCCTCCCATTCTTCTACCACC |
58 |
3 |
0.43 |
1.29 |
Specific PCR-based primers were
used for determining mating types (MAT-1 and MAT-2) in 65 FOC isolates. Both
mating types specific gene amplified in collected isolates. A 320 bpamplicon from MAT-1 gene was obtained in 39 isolates.
Similarity, a 650 bpamplicon from MAT-1 gene observed
in 26 FOC isolates (Fig. 1). Interestingly, among 21 FOC isolates collected
from Kurdistan province, only 4 isolate showed MAT-2 gene, while FOC isolates
from Kermanshah province showed both MAT genes, although the frequency of MAT-1
was higher than MAT-2 (Table 1).
Microsatellite markers
analysis and diversity pattern of FOC isolates
Ten SSR markers comprised six genic-SSRs and four
EST-SSRs were used for genetic diversity analysis in 65 FOC isolates. A total
of 30 alleles (21 by genic-SSRs and 9 by EST-SSRs) were amplified across all
FOC isolates with average of 3 alleles per locus (Table 2). Polymorphism
information content (PIC) of SSR markers ranged from 0.29 (FOL4) to 0.64 (MB18)
with an average value of 0.40. Marker index ranged from 0.58 to 2.56, with an
average value of 1.26. Cluster analysis based on SSR markers, grouped 65 FOC
isolates into 4 groups (Fig. 2). Cluster I comprised 28 FOC isolates, which all
of them collected from Kermanshah province. Cluster II contained 6 FOC isolates
that all from Kermanshah. Cluster III comprised 24 isolates, which divided into
two sub-clusters. Sub-cluster I comprised FOC isolates collected from Kurdistan
province and another sub-cluster contained four FOC isolates from Kurdistan and
6 isolates from Kermanshah province. Cluster IV, contained 7 FOC isolates from
both Kermanshah and Kurdistan provinces (Fig. 2).
Table 3: Analysis of molecular variance (AMOVA) within and between FOC
populations based on SSR markers
|
SOV |
df |
SS |
MS |
% of variation |
P value |
|
Among
populations |
1 |
42.17 |
42.17** |
6.5 |
0.01 |
|
Within
populations |
63 |
183.18 |
2.90 |
93.5 |
|
|
Total |
64 |
225.35 |
3.52 |
100 |
|
%201101-1106_files/image002.png)
Fig. 1: Amplification
profile obtained with mating type specific marker (a), genic-SSR (b), EST-SSR (c) markers in F. oxysporum
f. sp. ciceri isolates
%201101-1106_files/image004.png)
Fig. 2: Neighbor joining
(NJ) phylogenetic tree using SSR molecular data in 65 F. oxysporum f. sp. ciceri isolates
The AMOVA analysis based on
SSR markers data showed 6.5% of the variation among populations and 93.5%
between populations (Table 3). In general, our results showed relatively clear
pattern of diversity between isolates according to their geographical
collection site, that suggest the impact of environmental conditions on
population genetics on FOC isolates.
Discussion
FOC is known as highly variable fungi in morphology,
virulence ability that consists of different races and pathotypes
(Jendoubi et al. 2017). Study of genetic
diversity of pathogens is critical for effective management of disease,
selection of resistant chickpea sources and development of resistant cultivars,
especially if isolates are collected from various agro-climatic zones (Gurjar et al. 2009). In this context, pathogenicity
and molecular markers viz. genic- SSR, EST-SSR and mating type locus were
employed for genetic diversity in 65 Iranian FOC isolates that collected from
West of Iran (Kermanshah and Kurdistan provinces). All FOC isolates in this
study showed virulent pattern on susceptible chickpea cv. Bivanij.
Four and five isolates showed less and highly virulence, respectively.
Remaining isolates showed moderately virulent (21–50% wilt damage). Previously,
most of isolates used in this study, has been characterized for their
morphological characteristics like as colony color and clamydospore
position (Montakhabi et al. 2018) and based on
present results there is no significant correlation between geographically
distribution of these isolates with virulence pattern and morphological
attributes.
Pathogenicity and fitness of
fungi may be influenced by mating types (Arie et
al. 2000). In FOC fungi the mating types are controlled by two alleles in a
locus (MAT-1 and MAT-2) related to alpha box domain and HMG box domain,
respectively (Cepni et al. 2013). Our results
for mating type characterization using specific PCR-based primers showed
relatively equal distribution of both alleles (60% MAT-1 and 40% MAT-2) in FOC
isolates without positive correlation with collection origins, which is
agreement with previous reports for distribution of mating types in different Fusarium species from different countries (Irzykowska et al. 2013; Kashyap
et al. 2015, 2016). None of Isolates showed both MAT alleles, which can
be concluded that FOC has a heterothallic origin and previous studies supported
the hypothesis for sporadic and cryptic sexual cycle in Fusarium
species (Taylor et al. 1999; Kashyap et al.
2016). Similar results have been reported for un-equal distribution of MAT
alleles for F. oxysporum ioslates
in different crop species like as common bean (Karimian
et al. 2010). Although the maximum effective reproductive occurred when
1:1 ration observed in mating type idiomorphes, but
it seems that MAT-1 is a predominant mating type in the FOC population in Iran,
even a larger population from diverse geographical regions needed to be
analyzed before making a final decision.
Ten SSR markers used in this
study showed relatively high allelic variation in FOC isolates. The
polymorphism of SSR markers showed 2 to 4 alleles with an average 3 alleles per
locus. The average PIC value for SSR markers ranged from 0.29 to 0.64 with an
average value of 0.40. Highly PIC value of SSR marker types revealed in this study
showed the diverse nature of collected FOC isolates and was comparable with
previous studies using SSR markers in different Fusarium species (Mahfooz et al. 2012; Kumar et al. 2012, 2013).
Cluster analysis based on SSR
markers, grouped 65 FOC isolates into 4 groups. In general, FOC isolates from
Kurdistan provinces grouped distinctly from dose collected from Kermanshah. Our
results showed that over 93.5% of genetic diversity was distributed within
populations and isolates from close geographical distance. This highly genetic
similarity of FOC isolates may be concluded by gene flow due to movement of
conidia by contaminated seeds or infected plant debris from short distances
geographical regions.
This is in agreement with previous
reports stated that FOC is a monophyletic group which is derived from small
size population or single individual and somatic recombination occurred through
parasexuality (Jimenez-Gasco
et al. 2001). Although, high degree of pathogenic and genetic diversity
in FOC as a asexual fungi may occur by accumulation of
mutations over time (Jendoubi et al. 2017; Nourollah and Aliaran 2017).
In this study, pathogenicity
test for identification of FOC races are not used, because it can be influenced
by environmental factors and inoculum density of pathogens (Navas-Cortes
et al. 2007; Kashyap et al. 2016).
Therefore, characterization of FOC isolates using both SSR markers and mating
type specific markers enable us to effectively detect the level of genetic
diversity in collected FOC isolates. This information may provide insights into
the evolutionary processes of FOC isolates caused by migration, gene flow
between populations and epidemiology of pathogen. The results are also very
useful for developing integrated strategies for disease management and drawing
effective breeding programs for stable and effective resistance against FOC in
growing chickpea zones from West of Iran.
Conclusion
The present study showed high genetic diversity in
Iranian FOC populations. Moreover, to the best of our knowledge, the present
study provides first report regarding to genetic diversity of FOC isolates from
West of Iran using EST-SSR and mating type specific primers. Diversity analyses
carried out using genic- and EST-SSR markers grouped the isolates into three
clusters. High proportion of diversity was among isolates and high similarity
was observed between populations from distinct geographical regions, which are
valuable information for FOC pathogen population. Therefore, this high
similarity between populations can be concluded that gene flow may occur across
long distances by distribution of infected seed. These results will help
breeder to choose strategies for regional breeding programs for developing FOC
resistance chickpea cultivars and prevent to introduction of more diverse
isolates into these populations and prevent transmission any isolates from this
area to other regions of the country.
Acknowledgements
We would like to thank Vice
chancellor for research for his partial financial support. This paper is part
of requirements to fulfill for PhD degree of the first author, Mohammad Kazem
Montakhabi, at the Department of Plant Protection, College of Agriculture, at
Shahid Bahonar University of Kerman, Kerman, Iran.
References
Aghamiri A, R Mehrabi, R Talebi (2015). Genetic diversity of Pyrenopheratritici-repentis
isolates, the causal agent of wheat tan spot disease from northern Iran. Iran
J Bioethanol 13:39‒44
Ahmadi SRDA, M Parsa, M Bannayan, MN Mahallati, R Deihimfard (2014). Yield gap analysis of chickpea under
semi-arid conditions: A simulation study. Intl J Plant Prod 8:531‒548
Arie T, I Kaneko, T Yoshida, M Noguchi, Y Nomura, I
Yamaguchi (2000). Mating-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum
and Alternaria alternata.
Mol Plant Microb
Interact 13:1330‒1339
Barve MP, MP Haware, MN Sainani, PK Ranjekar, VS Gupta (2001).
Potential of microsatellites to distinguish four races of Fusarium oxysporum f.
sp. ciceri prevalent in India. Theor Appl Genet 102:138‒147
Bogale M, BD Wingfield, MJ Wingfield, ET Steenkamp (2005).
Simple sequence repeats markers for species in the Fusarium
oxysporum complex. Mol
Ecol Notes 5:622‒624
Cepni E, B Tunal, F Gurel (2013). Genetic diversity and
mating types of Fusarium culmorum and Fusarium
graminearum originating from different
agro-ecological regions in Turk. J Basic Microbiol
53:686‒694
Cook D, E Barlow, L Sequeira (2012).
Genetic diversity of Fusarium oxysporum f. sp. ciceri:
detection of restriction fragment length polymorphisms with DNA probes that
specify virulence and the hypersensitive response. Mol
Plant Microb Interact
2:113‒121
Dubey SC, SR Singh (2008). Virulence analysis and
oligonucleotide fingerprinting to detect diversity among Indian isolates of Fusarium oxysporum
f. sp. ciceri causing chickpea wilt. Mycopathology 165:389‒406
Farahani S, R Talebi, M Maleki, R Mehrabi, H Kanouni (2019). pathogenic
diversity of Ascochytarabiei isolates and
identification of resistance sources in core collection of chickpea germplasm. Plant Pathol J
35:321‒329
Ghaffari P, R Talebi, F Keshavarzi (2014). Genetic diversity and
geographical differentiation of Iranian landrace, cultivars, and exotic
chickpea lines as revealed by morphological and microsatellite markers. Physiol Mol Biol Plants 20:225‒233
Gurjar G, M Barve, A Giri, V Gupta (2009). Identification of Indian pathogenic races of Fusarium
oxysporum f.
sp. ciceri with gene specific, ITS
and random markers. Mycologia 101:484‒495
Haware, MP, YL Nene (1982). Races of Fusarium oxysporum f.
sp. ciceri. Plant Dis 66:809‒810
Haware MP, YL Nene, M Natarajan (1996).
Survival of Fusarium oxysporum f. sp. ciceri
in soil absence of chickpea. Phytopathol
Medit 35:9‒12
Irzykowska L, J Bocianowski, A Baturo-Cieśniewska (2013). Association of mating-type with mycelium growth rate and genetic
variability of Fusarium culmorum.
Cent Eur J Biol 8:701‒711
Jendoubi W, M Bouhadida, A Boukteb, M Béji,
M Kharrat (2017). Fusarium wilt affecting chickpea
crop. Agriculture 7; Article 7030023
Jimenez-Gasco MM, E Perez-Artes, RM
Jimenez-Diaz (2001). Identification
of pathogenic races 0, 1B/C, 5, and 6 of Fusarium
oxysporum f. sp. ciceri
with random amplified polymorphic DNA (RAPD). Eur
J Plant Pathol 107:237‒248
Karimian B, M Javan-Nikkhah,
M Abbasi, K Ghazanfari (2010). Genetic diversity of Fusarium
oxysporum isolates from common bean and
distribution of mating type alleles. Iran J Biotechnol
8:90‒97
Kashyap PL, S Rai,
S Kumar, AK Srivastava (2016). Genetic diversity, mating types and
phylogenetic analysis of Indian races of Fusarium
oxysporum f. sp. ciceri
from chickpea. Arch Phytopathol Plant Prot 49:533‒553
Kashyap PL, S Rai,
S Kumar, AK Srivastava, M Anandaraj,
AK Sharma (2015). Mating type genes
and genetic markers to decipher intraspecific variability among Fusarium udum
isolates from pigeon pea. J Basic Microbiol
55:846‒856
Kumar S, S Rai, DK Maurya, PL Kashyap, AK Srivastava, M Anandaraj (2013). Crosss pecies transferability of microsatellite markers from Fusarium oxysporum
for the assessment of genetic diversity in Fusarium
udum. Phytoparasitica
41:615‒622
Kumar S, D Maurya, PL Kashyap, AK Srivastava (2012). Computational mining and genome wide distribution of
microsatellites in Fusarium oxysporumf.
sp. lycopersici. Not
Sci Biol 4:127‒131
Mahfooz S, DK Maurya, AK Srivastava, S Kumar, DK Arora (2012). A comparative in silico
analysis on frequency and distribution of microsatellites in coding regions of
three forma especiales of Fusarium
oxysporum and development of EST-SSR markers for
polymorphism studies. FEMS Microbiol Lett 328:54‒60
Mengist Y, S Sahile, A Sintayehu, S Singh (2018).
Evaluation of chickpea varieties and fungicides for the management of chickpea Fusarium wilt
disease (Fusarium oxysporum
f. sp. ciceri) at adet
sick plot in Northwest Ethiopia. Intl J Agron 2018;
Article 6015205
Mohamed OE, A Hamwieh, S Ahmed,
NE Ahmed (2015). Genetic variability of Fusariumoxysporum
f. sp. ciceri population affecting
chickpea in the Sudan. J Phytopathol 163:941‒946
Montakhabi MK, GH Shahidibonjar, R Talebi (2018). Genetic diversity and population structure
of Iranian isolates of Fusarium oxysporum f.
sp. ciceri, the causal agent of
chickpea wilt, using ISSR and DAMD-PCR markers. Environ Exp
Biol 16:291‒298
Navas-Cortes JA, BB Landa, MA Mendez Rodrıguez, RMJ Dıaz (2007). Quantitative modeling of the effects of temperature and
inoculum density of Fusarium oxysporum f. sp. ciceri
races 0 and 5 on the development of Fusarium wilt in chickpea cultivars. Phytopathology
97:564‒573
Nourollah KH, A Aliaran
(2017). Genetic structure of Fusarium
oxysporum f.
sp. ciceri populations from chickpea in
Ilam province, Iran. Mycol
Iran 4:93‒102
Pande S, JN Rao, M Sharma (2007).
Establishment of the chickpea wilt pathogen Fusarium oxysporum f.
sp. ciceri in the soil through seed
transmission. Plant Pathol J 23:3‒6
Perrier X, JP Jacquemoud-Collet (2006). DARwin software,
http://darwin.cirad.fr/darwin
Sharma M, RK Varshney, JN Rao, S Kannan, D Hoisington, S Pande (2009). Genetic diversity in Indian isolates of Fusarium oxysporum
f. sp. ciceri, chickpea wilt pathogen. Afr J Biotechnol
8:1016‒1023
Sivaramakrishnan S, K Seetha, SD Singh (2002).
Genetic variability of Fusarium wilt pathogen
isolates of chickpea assessed by molecular markers. Mycopathology
155:171‒178
Soltani A, A Hajjarpour, V Vadez (2016). Analysis of chickpea yield gap and water-limited
potential yield in Iran. Field Crops Res 185:21‒30
Talebi R, AM Naji,
F Fayaz (2008). Geographical patterns of genetic
diversity in cultivated chickpea (Cicer arietinum L.) characterized by amplified fragment
length polymorphism. Plant Soil Environ 54:447‒452
Taylor JW, DM Geiser, A Burt, V Koufopanau (1999). The evolutionary biology and population genetics underlying fungal
strain typing. Clin Microbiol Rev, 12:126‒146
Waalwijk
C, A Keszthelyi, TVD Lee, A Jeney, ID Vries, Z Kerenyi, O Mendes, L Hornok (2006).
Mating type loci in Fusarium: structure and
function. Mycotox Res 22:54‒60